Composite

Part:BBa_K3306002:Design

Designed by: Ashima Khanna   Group: iGEM19_MITADTBIO_Pune   (2019-10-19)


K+ responsive KdpF promoter with GFP


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 722


Design Notes

According to iGEM HKUST-Rice 2015 team, the wild type KdpF promoter has an illegal EcoR1 restriction site. Therefore they mutated the thymine at -15 position to guanine, cytosine, and adenine. For our project, we've used the guanine mutated KdpF promoter. We have added EcoR1 sites at the end of the KdpF sequence. Primers designed:
Kdp_F: ATCAGAATTCTGCCATTTTTATACTTTTTT
Kdp_R: CTGAGAATTCCAGAAATCTACCCTTCCGGT

Source

KdpF promoter was synthesized de novo. The ligation was done using RFC10 standards.

References

Epstein, W., & Kim, B. S. (1971). Potassium transport loci in Escherichia coli K-12. Journal of Bacteriology, 108(2), 639-644.

International Plant Nutrition Institute. (1998). Functions of Potassium in Plants. Better Crops, 82(3).

Jung, K., Tjaden, B., & Altendorf, K. (1997). Purification, reconstitution, and characterization of KdpD, the turgor sensor of Escherichia coli. Journal of Biological Chemistry, 272(16), 10847-10852.

Jung, K., Veen, M., & Altendorf, K. (2000). K+ and ionic strength directly influence the autophosphorylation activity of the putative turgor sensor KdpD of Escherichia coli. Journal of Biological Chemistry, 275 (51), 40142-40147.

Jung, K., Krabusch, M., & Altendorf, K. (2001). Cs+ Induces the kdp operon of Escherichia coli by Lowering the Intracellular K+ Concentration. Journal of bacteriology, 183(12), 3800-3803.

Kelly, J. R., Rubin, A. J., Davis, J. H., Ajo-Franklin, C. M., Cumbers, J., Czar, M. J., ... & Endy, D. (2009). Measuring the activity of BioBrick promoters using an in vivo reference standard. Journal of biological engineering, 3(1), 4.

Keseler et al. (2013), EcoCyc: fusing model organism databases with systems biology, Nucleic Acids Research 41: D605-12.

Laermann, V., Ćudić, E., Kipschull, K., Zimmann, P., & Altendorf, K. (2013). The sensor kinase KdpD of Escherichia coli senses external K+. Molecular microbiology, 88(6), 1194-1204.

Laimins, L. A., Rhoads, D. B., & Epstein, W. (1981). Osmotic control of kdp operon expression in Escherichia coli. Proceedings of the National Academy of Sciences, 78 (1), 464-468.

Narayanan, A., Paul, L. N., Tomar, S., Patil, D. N., Kumar, P., & Yernool, D. A. (2012). Structure-function studies of DNA binding domain of response regulator KdpE reveals equal affinity interactions at DNA half-sites. PloS one, 7(1), e30102.

Polarek, J. W., Williams, G., & Epstein, W. (1992). The products of the kdpDE operon are required for expression of the Kdp ATPase of Escherichia coli. Journal of bacteriology, 174 (7), 2145-2151.

Roe, A. J., McLaggan, D., O’Byrne, C. P., & Booth, I. R. (2000). Rapid inactivation of the Escherichia coli Kdp K+ uptake system by high potassium concentrations. Molecular microbiology, 35(5), 1235-1243.

Sugiura, A., Nakashima, K., Tanaka, K., & Mizuno, T. (1992). Clarification of the structural and functional features of the osmoregulated kdp operon of Escherichia coli. Molecular microbiology, 6(13), 1769-1776.

Voelkner, P., Puppe, W., & Altendorf, K. (1993). Characterization of the KdpD protein, the sensor kinase of the K+‐translocating Kdp system of Escherichia coli. European Journal of Biochemistry, 217(3), 1019-1026.

Walderhaug, M. O., Polarek, J. W., Voelkner, P., Daniel, J. M., Hesse, J. E., Altendorf, K., & Epstein, W. (1992). KdpD and KdpE, proteins that control expression of the kdpABC operon, are members of the two-component sensor-effector class of regulators. Journal of bacteriology, 174(7), 2152-2159.

Yan, H., Fukamachi, T., Saito, H., & Kobayashi, H. (2011). Expression and activity of Kdp under acidic conditions in Escherichia coli. Biological and Pharmaceutical Bulletin, 34(3), 426-429.

Zhang, L., Jiang, W., Nan, J., Almqvist, J., & Huang, Y. (2014). The Escherichia coli CysZ is a pH dependent sulfate transporter that can be inhibited by sulfite. Biochimica et Biophysica Acta (BBA)-Biomembranes, 1838(7), 1809-1816.